30 setembro, 2010

Desconfiar desconfiando

Mauro Santayna, "As duas faces da candidata". 
In: Jornal do Brasil Digital, 30/09/10
"O SÚBITO INTERESSE, de alguns meios de comunicação e de setores empresariais poderosos, pela candidatura da senadora Marina Silva, recomenda aos nacionalistas brasileiros alguma prudência. A militante ecológica é apresentada ao país como a menina pobre, da floresta profunda, que só se alfabetizou aos 16 anos e fez brilhante carreira política. Tudo isso é verdade, mas é preciso saber o que pensa realmente a senadora do Brasil como um todo.
Convém lembrar que a senhora Silva (que hoje se vale do sobrenome comum para atacar Dilma Rousseff) esteve associada a entidades internacionais, e recebeu o apoio declarado de personalidades norte-americanas, como Al Gore e o cineasta James Cameron.
James Cameron, autor de um filme de forte simbolismo racista e colonialista, Avatar, intrometeu-se em assuntos nacionais e participou de um encontro contra a construção da represa de Belo Monte. A respeitável trajetória humana da senadora pelo Acre não é bastante para fazer dela presidente da República. Seu comportamento político, ao longo dos últimos anos, suscita natural e fundada desconfiança dos brasileiros.
Seus admiradores estrangeiros pregam abertamente a intervenção na Amazônia, “para salvar o mundo”. Não são os ocupantes do vasto território que ameaçam o mundo. São as grandes potências, com os Estados Unidos de Gore em primeiro lugar, que, sustentando grandes e bem equipados exércitos, pretendem governar todos os povos da Terra.
Al Gore, que festejou a candidatura verde, é o mesmo que pronunciou, com todas as sílabas, uma frase reproduzida pela imprensa: “Ao contrário do que os brasileiros pensam, a Amazônia não é só deles, mas de todos nós”. Desaforo maior é difícil. Ninguém, de bom senso, quer destruir a Natureza, e será necessário preservar a vida em todo o planeta, não só na Amazônia.
A senadora Marina Silva tem sido interlocutora ativa das ONGs internacionais, tão zelosas em defender os índios da Amazônia e desdenhosamente desinteressadas em ajudar os nativos da região de Dourados, em Mato Grosso do Sul, dizimados pela doença, corrompidos pelo álcool e, não raras vezes, assassinados por sicários. Argumente-se, em favor da senadora, que o seu fervor quase apostólico na defesa dos povos da Floresta dificulta-lhe a visão política geral.
Mas seu apego a uma só bandeira, a da ecologia radical, e o fundamentalismo religioso protestante que professa, reduzem as perspectivas de sua candidatura. Com todos os seus méritos e virtudes, não é provável que entenda o Brasil em toda a sua complexidade, em toda a sua inquietude intelectual, em toda a sua maravilhosa diversidade regional. As conveniências da campanha eleitoral já a desviaram de alguns de seus compromissos juvenis.
Esse seu pragmatismo está merecendo a atenção do ex-presidente Fernando Henrique, que pretende um segundo turno com a aliança entre Serra e Marina. Como sempre ocorre com os palpites políticos do ex-presidente, essa declaração é prejudicial a Serra e, provavelmente, também a Marina. Ela, vista por muitos como inocente útil daqueles que nos querem roubar a Amazônia, é vista pelo ex-presidente como inocente útil da candidatura dos tucanos de São Paulo .
É possível desculpar a ingenuidade na vida comum, mas jamais aceitá-la quando se trata das razões de Estado. José Serra poderia ter tido outro desempenho eleitoral, se tivesse desouvido alguns de seus aliados, como Fernando Henrique, que lhe debitou a política de privatizações, e Cesar Maia, que lhe impôs o inconveniente e troglodita Indio da Costa como vice. O apego de Marina a uma só bandeira e o fundamentalismo religioso não a ajudam."

Post scriptum
Emir Sader, "Marina, a queridinha da mídia". In: Carta Maior, 24/09/10

A camisinha que morde

No triste ranking das mulheres violentadas a África do Sul ocupa o primeiro lugar no mundo. De acordo com um levantamento recente feito no país, 28 por cento dos homens sul-africanos já violaram uma mulher (ou uma menina). Porém, mais do que a contundência destes números, foi o contato com uma das vítimas que fez Sonnet Ehlers, uma médica sul-africana, desenvolver o protótipo de uma camisinha anti-violação.
A ideia partiu de uma confidência que a vítima fez à médica:
"Quem me dera ter dentes lá em baixo."
A ser usada como um preservativo feminino, a camisinha se fixa através de farpas ao pênis (muito dolorosamente) e do qual só pode ser retirada através de uma cirurgia.

Vídeo


29 setembro, 2010

Policlínicas Regionais no Ceará

Ontem (28/09), às 17 horas, foi inaugurada pelo Secretário da Saúde do Estado do Ceará, Dr. Arruda Bastos, a Policínica Regional de Baturité. Resultado de um investimento de cerca de 8 milhões de reais, totalmente oriundo do tesouro estadual, esta políclínica será administrada por um consórcio em que estão representados os 8 municípios da região: Aracoiaba, Aratuba, Baturité, Capistrano, Guaramiranga, Itapiúna, Mulungu e Pacoti.
Atenderá à população residente no Maciço de Baturité (135 mil habitantes) com os serviços de oftalmologia, otorrinolaringologia, clínica geral, cardiologia, ginecologia, mastologia, cirurgia geral, gastroenterologia, urologia, traumato-ortopedia; com o apoio técnico de enfermagem, farmácia clínica, terapia ocupacional, fisioterapia, fonoaudiologia, nutrição, psicologia e assistência social; e com os serviços auxiliares de diagnóstico em radiologia convencional, mamografia, ultrassonografia, endoscopia digestiva, ecocardiografia, ergometria, eletrocardiografia, audiometria e exames de patologia clínica.
A Policlínica Clóvis Amora Vasconcelos (nome em homenagem a um cirurgião-dentista, nascido em Redenção, que, durante muitos anos, dirigiu o Posto de Saúde de Baturité) é a segunda das policlínicas regionais entregues à população pelo atual governo do Estado do Ceará. A primeira foi a de Tauá, inaugurada na última sexta-feira (24/09), e a terceira delas está sendo inaugurada hoje (29/09) na cidade de Camocim. Mais 18 outras unidades encontram-se em construção no interior, para serem em breve administradas por consórcios municipais, numa experiência em que o Ceará está servindo de modelo para o país.


A solenidade de inauguração da Policlínica de Baturité foi também uma oportunidade para que eu reencontrasse o médico sanitarista Francisco das Chagas Dias Monteiro. O colega, que sofreu recentemente uma grave enfermidade, e da qual se recuperou - sem sequelas - está em plena forma para a medicina, a política e a poesia. PGCS

Um antílope e seu website




Frank Solomon (Solent News & Photo Agency) captou em sua câmera a imagem deste antílope num safari que fez no Kruger National Park, África do Sul.

Garagens

:-)

28 setembro, 2010

The play after


Um garotinho gordo brincou aqui.
Itapiúna -CE

Um código de barras biodegradável

Quando eu vejo funcionalidades deste tipo é que me pergunto porque elas já não fazem parte de nosso cotidiano. Como o Fresh Code, um produto da imaginação de um grupo de designers japoneses, para ser uma solução curiosa a fim de garantir que os frutos e os produtos hortícolas (embora eu suponha que possa ser aplicado em qualquer produto) estejam sempre frescos para os consumidores.


Como vocês podem ver na imagem acima, é um código de barras. Mas impresso com uma tinta especial para se apagar ao longo de um certo tempo. Assim, quando o vegetal codificado estiver com a validade vencida, o código também terá desaparecido. E o comprador, mesmo que o queira, não conseguirá levar o produto para a casa porque este não poderá passar pela caixa registradora. Muito inteligente.

27 setembro, 2010

O sonho do rinoceronte

:-)

"Rinocerontes são unicórnios gordos."

Sepultus hic est

Nasceu em maio e morreu em fevereiro... do mesmo ano
No piso da Catedral de Salisbury, na Inglaterra, existe o túmulo de uma criança que, de acordo com a inscrição na lápide, nasceu no dia 13 de maio de 1683 e morreu em 19 de fevereiro do mesmo ano.
Como foi possível?
Em 1683, o ano somente se iniciava em 25 de março na Inglaterra, por esse país ainda estar observando o calendário juliano (apenas a partir de 1752 foi que a Inglaterra veio a aderir ao calendário gregoriano).
Assim, ao morrer em fevereiro, ainda estava no mesmo ano a criança que nascera em maio de 1683.

Traduzido da Minificha 63 do site La Aldea Irreductible

26 setembro, 2010

Cavernas famosas

Espeleólogos do mundo inteiro, no dia de encerramento de seu último congresso, o qual foi realizado na Gruta de Ubajara - Ceará, escolheram as 7 cavernas mais famosas do mundo:

- a caverna de Platão
- a caverna de Batman
- a caverna do Dragão
- a caverna de Ali Babá
- a caverna do Jedi
- a caverna do pulmão de Manuel Bandeira
- a caverna do Ostracismo, fundos.

Esta última (imagem), apesar de mundialmente menos conhecida, fica em Higienópolis, na capital paulista. É, desde 2003, o endereço residencial do sociólogo udenista FHC e passa atualmente por uma ampliação a fim de abrigar um maior número de inquilinos.
Ler sobre a reforma da caverna em Tia Carmela e o Zezinho.

Imprime e impressiona

Parece irreal, surreal, sei lá... mas é uma impressora feita de LEGO e que funciona.


Clique aqui para ver uma nota que escrevi no blog, em 01/02/2008, sobre o LEGO.

Ver também Monster Chess.

25 setembro, 2010

♪As canções que você mixou para mim♪

♪Pai, você foi meu herói, meu bandido, safado, cachorro, sem vergonha! Eu dou duro o dia inteiro e você colchão e fronha!♪
♪Meu limão meu limoeiro, meu pé de jacarandá, uma vez Flamengo, sempre Flamengo.♪
♪Dos filhos deste solo és mãe gentil, pátria amada, Brasil...meu Brasil brasileiro... meu mulato inzoneiro...♪
♪Na rua, na chuva, na fazenda ou numa festa lá no meu apê, pode aparecer, vai rolar bunda-lê-lê.♪
♪India, seus cabelos raspadinhos, estilo Ronaldinho.♪
♪É o amor que mexe com minha cabeça e me deixa assim, assim, assim: uma mão vai na cabeça... o movimento é sexy!♪
♪Amigo é coisa pra se para se guardar, debaixo de sete chaves, todos atentos olhando pra TV, lá vem o Chaves, o Chaves...♪
♪Ciranda, cirandinha vamos todos cirandar vamos dar a meia... Volta, vem viver outra vez ao meu lado.♪
♪Você foi o maior dos meus casos, de todos os acasos... bem marcados em carta de tarô... ô-ô-ô!♪
♪Quem sabe o príncipe virou sapo...não lava o pé , não lava porque não quer.♪
♪Amigo é coisa pra se guardar, debaixo.. dos caracóis, dos teus cabelos, uma história pra contar, de um mundo tão distante.♫
♪Eu quero ter um milhão de amigos e bem mais forte poder cantar... e cantar e cantar a beleza de ser um eterno aprendiz.♪
♪ Brasil, mostra sua cara..... Caramba cara caraô! Caracarambacaracaraô...♪
♪Gigante pela própria natureza... mas que beleza, em fevereiro, em fevereiro, tem carnaval, tem carnaval...♪

No melhor dos mundos possíveis

No século XVIII, Voltaire criou o Professor Pangloss, o preceptor de Cândido, personagem principal do romance "Cândido ou o Otimismo". Pangloss representava o filósofo dogmático que, por mais desgraças que presenciasse, dizia sempre que “tudo vai pelo melhor no melhor dos mundos possíveis (tout est pour le mieux dans le meilleur des mondes possibles)”.
Ah, fosse do tempo atual que Pangloss certamente ia vidrar nestes óculos!


Curiosidade
O romance de Voltaire foi adaptado para as telas por Mazzaropi, no filme Candinho, apresentando, no entanto, uma mensagem oposta à de Voltaire, com o compositor Adoniran Barbosa (do "Trem das Onze") no papel do Professor Pancrácio (a versão brasileira de Pangloss, no filme).

24 setembro, 2010

Bicicultura


No Dia Mundial sem Carro (22/09), o leitor Marcelinho, me escreveu para comunicar a existência de uma nova ONG em João Monlevade - MG (Olá, Nelson Cunha). Trata-se da AMOBIKE, a Associação Monlevade de Bicicultura, dedicada à promoção do transporte à propulsão humana e à defesa dos interesses daqueles que, como meio de locomoção, lazer ou esporte, curtem o ciclismo.
A AMOBIKE desenvolve também um blogsite. Aqui divulgo o seu endereço eletrônico: http://amobike.wordpress.com

Post scriptum
Atualmente pratico caminhadas. Mas jamais consegui esquecer MINHA SUPERFATURADA BICICLETA.

A derradeira cartada


Dia 25, amanhã, a revista das iniquidades tenta sua derradeira cartada para salvar do sufrágio naufrágio a candidatura daquele que, por direito divino, deveria ser o presidente do Brasil desde 2003. Na reporcagem de capa, a revista traz um pré-sal de denúncias contra o Usurpador do Planalto, Dilma, Luan Santana, o goleiro Bruno, Dona Florinda, Filhote de Gatinho, Rodriguinho dos Travessos e o Cachorro-Lagosta. E mais, muito mais. Traz também pesadas acusações contra Erenice, Fábio Jr, Lucas Celebridade, o rato Xaropinho e o Pedro do Cadê Meu Chipêêê.
É preciso que não fique um grão de areia sobre outro até mesmo nos Lençóis Maranhenses. Para isso, a reporcagem de capa da última flor do fáscio (que está sendo antecipada pelo Quanto Tempo Dura?) é fio desencapado puro. Pisou, leva choque. Foi totalmente obtida de fontes sigilosas: pseudocontadores, ex-presidiários e chantagistas em geral. E os denunciados que tratem de obter as provas materiais de que são realmente inocentes. E bem rápido. Repercutirão essa matéria: a Folha de São Paulo, a Rede Globo (casal 45, no Jornal Nacional), o ViceIndio, a Soninha Toda Nua e um combativo político da UDN, o qual fará a sua leitura no Senado com vistas à abertura de mais uma CPI do Fim do Mundo.
Para tornar essa reporcagem mais impactante, a revista cuidou de acrescentar uma montanha de dinheiro na fotografia de capa da edição. Não foi dinheiro cenográfico, foi uma amostra dos 34,7 milhões de reais que a Editora Abril recebeu do Governo de São Paulo, entre 23 de outubro de 2007 e 16 de junho de 2009, como pagamento das assinaturas de suas revistas. PGCS
(...)
"O que está ocorrendo já não é um enfrentamento de ideias e de interpretações e o uso legítimo da liberdade da imprensa. Está havendo um abuso da liberdade de imprensa que, na previsão de uma derrota eleitoral, decidiu mover uma guerra acirrada contra o Presidente Lula e a candidata Dilma Rousseff. Nessa guerra vale tudo: o factóide, a ocultação de fatos, a distorção e a mentira direta.
Precisamos dar o nome a esta mídia comercial. São famílias que, quando veem seus interesses comerciais e ideológicos contrariados, se comportam como "famiglia" mafiosa. São donos privados que pretendem falar para todo Brasil e manter sob tutela a assim chamada opinião pública. São os donos de O Estado de São Paulo, de A Folha de São Paulo, de O Globo, da revista Veja, na qual se instalou a razão cínica e o que há de mais falso e chulo da imprensa brasileira. Estes estão a serviço de um bloco histórico assentado sobre o capital que sempre explorou o povo e que não aceita um Presidente que vem desse povo. Mais que informar e fornecer material para a discusão pública, pois essa é a missão da imprensa, esta mídia empresarial se comporta como um feroz partido de oposição."
(...)
Leonardo Boff, Adital

23 setembro, 2010

"Não é o DNA, estúpido!"

A pergunta de um leitor no Art of Trolling:
"O que no DNA de um gato doméstico impede que ele cresça até o tamanho de um grande felino?"
E a resposta de outro leitor:
"Não está no DNA do Felis catus. Está no fato de que o DNA alinha suas partes por meio de uma fosfatase que existe no rato. E, ao comê-lo, é isso o que mantém o gato pequeno."
Mark Johnson, o autor da resposta, mostrou ainda - em detalhes - como a coisa se processa:

>refNM_053473.1 Rattus norvegicus protein phosphatase 1, regulatory (inhibitor) subunit 9A (Ppp1r9a), mRNA
gbU72994.1RNU72994 Rattus norvegicus neurabin mRNA,
complete cds Length=3850
GENE ID: 84685 Ppp1r9a protein phosphatase 1, regulatory (inhibitor) subunit
9A [Rattus norvegicus] (Over 10 PubMed links)
Sort alignments for this subject sequence by:
E value Score Percent identity
Query start position Subject start position
Score = 80.5 bits (43), Expect = 1e-11
Identities = 48/50 (96%), Gaps = 2/50 (4%)
Strand=Plus/Minus
Query 640 GTAGTTGCTGTTCTCAGCCTTCCCAGGAGTGATGGCACCTGG-GCACTCA 688
Sbjct 912 GTAGTTGCTGTTCTCAGCCTTCCCAGGAGTGATGGCACCTGGAG-ACTCA 864
Score = 78.7 bits (42), Expect = 5e-11
Identities = 42/42 (100%), Gaps = 0/42 (0%)
Strand=Plus/Minus
Query 799 TTCTCTCAAACATCTTTCGAGTCTCTGTGAACTTAGCATACG 840
Sbjct 673 TTCTCTCAAACATCTTTCGAGTCTCTGTGAACTTAGCATACG 632
Score = 78.7 bits (42), Expect = 5e-11
Identities = 42/42 (100%), Gaps = 0/42 (0%)
Strand=Plus/Minus
Query 759 CCTCTCCCGCTTTCTCTTTCTTTGGGGAATGGCGATTATTTT 800
Sbjct 733 CCTCTCCCGCTTTCTCTTTCTTTGGGGAATGGCGATTATTTT 692
Score = 78.7 bits (42), Expect = 5e-11
Identities = 44/45 (97%), Gaps = 0/45 (0%)
Strand=Plus/Minus
Query 720 CAAGGAATCACTGCTGCCTCTATTGGACTTGGAGCCACCCCTCTC 764
Sbjct 792 CAAGGAATCACTGCTGCCTCTATTGGACTTGGAGCCACCCCACTC 748
Score = 78.7 bits (42), Expect = 5e-11
Identities = 42/42 (100%), Gaps = 0/42 (0%)
Strand=Plus/Minus
Query 599 AGGTATCCAGATTGGTTACGGTAACAGATGGTAAGTTCAGGG 640
Sbjct 973 AGGTATCCAGATTGGTTACGGTAACAGATGGTAAGTTCAGGG 932
Score = 78.7 bits (42), Expect = 5e-11
Identities = 42/42 (100%), Gaps = 0/42 (0%)
Strand=Plus/Minus
Query 559 CTGTGTCGGTAGCTTGTTTGTTTGAAGAAGGCCTTGAATTAG 600
Sbjct 1033 CTGTGTCGGTAGCTTGTTTGTTTGAAGAAGGCCTTGAATTAG 992
Score = 75.0 bits (40), Expect = 7e-10
Identities = 40/40 (100%), Gaps = 0/40 (0%)
Strand=Plus/Minus
Query 681 GGCACTCAGTTGGCTCACAGTTGGAGAGACAGCCTCCGTC 720
Sbjct 849 GGCACTCAGTTGGCTCACAGTTGGAGAGACAGCCTCCGTC 810
Score = 65.8 bits (35), Expect = 4e-07
Identities = 35/35 (100%), Gaps = 0/35 (0%)
Strand=Plus/Minus
Query 526 ACCTTTCTGAGCCACTTCCGGTACTGGCACAGCCT 560
Sbjct 1086 ACCTTTCTGAGCCACTTCCGGTACTGGCACAGCCT 1052

22 setembro, 2010

O que se pode fazer com o ovo

Sente nos ovos, digo, numa poltrona de ovos para poder assistir o que vem por aí...


Dia Mundial Sem Carro - 2010

Em 22 de setembro (hoje), milhões de pessoas ao redor do mundo comemoram o Dia Mundial Sem Carro.
É um dia para a reflexão sobre a dependência e o uso abusivo dos automóveis em nossa sociedade. Afinal de contas, tem gente que não vai até a esquina do quarteirão em que mora sem usar o carro.

carro x ônibus x bicicleta
DailyCognition faz uma comparação do espaço que eles ocupam para o transporte de 60 pessoas.


Para ler mais:

21 setembro, 2010

O canivete suíço - 2

ONTEM - com 3 ferramentas

HOJE - com 87 ferramentas

Fail Whale

Quem é usuário do Twitter já deve ter visto a Fail Whale. O desenho de uma graciosa baleia (não confundi-la com a Free Willy) que é transportada por um esquadrão de pássaros. Fail Whale, que foi desenhada pelo ilustrador chinês Yiying Lu, aparece naqueles momentos em que o Twitter se encontra sobrecarregado.


Se bem entendo o simbolismo da imagem, os pássaros retiram a baleia do alto mar e a e a deixam encalhada em alguma praia. Aí, em contato com a terra firme, qual o mitológico Anteu, a Fail Whale recupera logo suas energias.
Usuários do mundo inteiro têm criado outras versões (nem sempre com a presença da baleia) para essa mensagem visual do Twitter. Confiram 25 delas no Nadave.net.

20 setembro, 2010

Pela blogosfera - 40

Quero registrar dois agradecimentos:
1 - A Nonato Albuquerque, responsável pelos blogs Gente de Mídia, Antena Paranóica e Mouse ou Menos, pelas palavras de incentivo ao que venho fazendo em EntreMentes. O jornalista Nonato foi, talvez, o primeiro a acreditar em meu trabalho na blogosfera. Ontem (19/09), ele escreveu isto:
"Duo dos Gatos. Um Rossini clássico e gaiato
O médico Paulo Gurgel, irmão da jornalista Márcia Gurgel, tem um blog - 'Entrementes' - que é admirável de se ver. Gostoso, irreverente, cheio de novidades que ele cata pelo mundo da blogosfera e divide com seus leitores [ sou um deles ]. Ele postou ontem o 'Duo dos Gatos', admirável peça do compositor Rossini que é uma das peças do humor mais refinado. Eu vou compilar o texto explicativo do doutor PG e vocês aproveitem o domingo que é pra rir com música de boa qualidade."
2 - A Elany Moreira, que foi a competente secretária do Centro de Estudos do Hospital de Messejana durante o período em que exerci a sua presidência, por vir "retuitando" algumas de minhas postagens.

Confúcio disse?

Na web é comum a gente se deparar com estas frases:
Não use um canhão para matar um mosquito (Do not use a cannon to kill a mosquito).
Como sendo as versões em português e em inglês de uma das citações do filósofo Confúcio.

Refletindo...
Para ser inventado o canhão a pólvora teria de existir primeiro. E a pólvora só foi inventada, na China, em algum momento da dinastia Han, que durou de 206 a.C. até 220 d.C. Apenas no século X é que a pólvora começou a ser usada com propósitos militares, na forma de foguetes e bombas. Remonta ao século XII a primeira referência a um canhão. Era feito de bambu. A substituição do bambu por metal, dando origem ao primeiro canhão, só aconteceria em 1290 d.C. na China.
Vivendo por lá muito antes, de 551 a.C. a 479 a.C., e não tendo vocação para ser Julio Verne, teria o sábio chinês feito essa recomendação?

19 setembro, 2010

O guru que sabia de menos

Para turbinar sua combalida campanha eleitoral O Maior Administrador do País importou um guru norte-americano de ascendência indiana. Assim que aqui chegou, o guru Ravi Singh tomou duas medidas de impacto:
1) tirou do ar por 48 horas os principais sites da campanha e 2) mudou o slogan da mesma de "O Brasil Pode Mais" para "É Hora da Virada".
Acaba de receber o seu "bilhete azul". Numa das reuniões do comando da campanha, ele candidamente falou:
- Que é FHC?
O guru não sabia que, no Brasil, o ato de pronunciar certas palavras traz péssimos fluidos e pode inclusive justificar a rescisão de um contrato.


Falar nisso, FHC, que retornou de seu estratégico giro pela Europa, já está fazendo ginástica localizada nos dedos. Para segurar a alça do caixão de seu pupilo. PGCS

Miados rossinianos

Se alguém pensa que a música erudita não pode ser divertida é porque ainda não ouviu o "Duo dos Gatos" de Gioachino Rossini (1792-1868). O compositor trabalhou muito em sua juventude, logo se fez rico e famoso, e, com trinta e poucos anos, ele deixou de compor para desfrutar os prazeres da vida, dentre os quais o de uma boa mesa.
Rossini também era conhecido pelo senso de humor, ainda que não achasse graça quando os intérpretes de suas óperas se afastavam das respectivas partituras. E não sabemos se isto teve alguma influência para compor esta peça que vamos escutar. Há quem diga que ele a compôs em homenagem a um par de gatos que vinha visitá-lo, todas as manhãs, em sua casa de Pádua.



O "Duo dos Gatos" tem uma letra fácil, pois só emprega uma palavra: "miau". Mas, repetida de diversas formas, essa palavra acaba por trazer dificuldades vocais para seus intérpretes. Originalmente, foi composta para piano e duas vozes femininas, geralmente soprano e meio-soprano. Aqui, foi cantado por meninos do coro Petit Chanteurs à la Crois de Bois, em um concerto que teve lugar em Seul, a 30 de novembro de 1996.

Poderá gostar de ver:

18 setembro, 2010

Uma tentativa de domar a Natureza




Botei só o título.

Não concordo com o que a moça fez
nem acho que funcione.

Nassif no Ceará

Luis Nassif esteve ontem (17/09) no Ceará para dar uma palestra em Porto das Dunas, paradisíaca praia do município de Aquiraz. Após as 21 horas, o jornalista participou de um sarau que reuniu profissionais da mídia, músicos e blogueiros nas dependências do Country Club de Fortaleza (Restaurante Sirigado).
Nassif revezou-se ao bandolin com Saraiva, do regional "Cordas que Falam", e Aparecida Silvino deu uma canja vocal. Um agradável encontro.

Polegares, onde estão?

Curiosidades
O fio de cabelo pode suportar um peso de até 3 quilos.
A pele tem o dobro do peso do cérebro.
Se a saliva não consegue dissolver algo você não sentirá o sabor.
Um alimento leva cerca de 7 segundos para ir da boca ao estômago.
O tamanho do pênis corresponde a três vezes o do polegar.
O osso do quadril é quase tão forte quanto o concreto.
As mulheres piscam duas vezes mais do que os homens.
Seu corpo se utiliza de 300 músculos para mantê-lo em pé.
As mulheres já estão finalizando a leitura deste texto.
Os homens ainda não, pois estão medindo o comprimento de seus polegares.

17 setembro, 2010

Tucanos. Incompetência e sabotagem

1 O que vimos nesta campanha eleitoral em relação ao comportamento da oposição frente aos programas sociais do governo Lula foi de uma desqualificação e desfaçatez sem tamanho. Os mesmos programas federais durante oito anos atacados pela oposição - tucanos à frente - cujos benefícios foram por eles minimizados com desdém, tornaram-se "promessas" eleitorais deles. Sem contar que, em alguns casos, eles até arvoraram-se em "pais" de algumas ideias.
O Bolsa Família, chamado pela nossa oposição de "bolsa esmola" é um exemplo disto. Não preciso comentar aqui o que foi dito por eles, quando em 2003, o presidente Lula anunciou o programa que hoje atende 13 milhões de famílias e devolveu dignidade a milhões de necessitados deste país.
Já o Luz para Todos, criado em 2003, quando a atual candidata ao Planalto, Dilma Rousseff (PT-governo-partidos aliados) era ministra de Minas e Energia, já tirou das trevas cerca de 2 milhões de famílias brasileiras até o ano passado. O programa atende a um direito básico: a inclusão energética.
Frente a este número, o que podemos dizer dos tucanos? Lembrar que durante o governo FHC, o programa deles de eletrificação rural não contemplou nem 500 mil famílias.Ou seja, não conseguiram atingir nem 25% do que o governo Lula fez nesta área.
Pior do que a incompetência é a sabotagem do PSDB. No comando do governo de São Paulo há 16 anos, os tucanos dificultaram ao máximo a ampliação do Luz para Todos negando-se a parcerias para a execução do programa. Em 2004, Geraldo Alckmin, na época governador de São Paulo - agora é candidato ao cargo de novo - assinou um termo de participação do programa federal.


2 Dois anos depois, nada... Alckmin saiu candidato à presidência em 2006 afirmando que era necessária uma lei para tal parceria - uma lei jamais proposta por ele à Assembléia Legislativa. Quem a encaminhou foi seu vice e sucessor, o governador Cláudio Lembo (DEM).
Pouco depois, ao assumir o governo paulista, o tucano e atual candidato ao Planalto, José Serra (PSDB-DEM-PPS) dedicou o mais completo desprezo ao assunto. Mesmo assim, meus caros, o Programa Luz para Todos em São Paulo levou energia elétrica para cerca de 82 mil famílias (dados de junho/2010).
Assim, infelizmente, tive que expor mais um exemplo do boicote de Serra ao trabalho conjunto com o governo federal e falar de seus métodos antidemocráticos e não republicanos de governar, a despeito da real necessidade das famílias paulistas. Aliás, Serra no governo só age assim, sabotando programas sociais.
Outros dois exemplos estão na área da Saúde. São as UPAs (pronto socorros de 24 h) e o SAMU (ambulâncias de resgate). Os dois programas federais não contam com recursos do governo paulista que se nega a financiar a parte que lhe cabe nos custos - 50% do ministério da Saúde, 25% dos municípios e 25% do Estados - para a manutenção e ampliação destas iniciativas no Estado.
Resultado: esses programas aqui são financiados apenas com verbas federais e municipais, e São Paulo é o único dentre os 27 Estados a não cumprir com sua parte.

Transcrito do Blog do Zé Dirceu (16-Set-2010). Ilustração: Bira, via Blog do Celso Jardim.

Ditos e provérbios "personalizados"

Há ditos populares e provérbios que incluem nomes de pessoas. Até o momento anotei estes:
Miguel, Miguel, não tens abelhas e vendes mel.
Cazuza, babado se usa?
A César o que é de César.
Pedro, tu és pedra...
Mateus, primeiro os teus.
Quem pariu Mateus que o embale.
Agora é tarde, Inês é morta.
Enquanto o Brás é tesoureiro.
Ponha na conta do Abreu. Se ele não pagar... nem eu.
Jeremias, aperta a gata que ela mia.
Aí... morreu o Neves.
O pau que dá em Chico dá em Francisco.
Queres conhecer o Inácio? Coloca-o num palácio.
Feliz foi Adão que não teve sogra (nem caminhão).
Se souberem de outros do gênero, informem-me para que sejam acrescentados à lista.

16 setembro, 2010

Quem matou a "O"?

Num 15 de setembro, há 120 anos, nascia Agatha Christie, a escritora britânica de novelas policiais.
A influência de suas tramas de suspense ainda é hoje observada em mais da metade dos filmes de crimes e mistérios que são produzidos em Hollywood.
Dennis Hwang, o artista gráfico que desenha os logos comemorativos do Google, criou esta cena para homenagear a célebre novelista.

A "O" assassinada

Uma das outras letras do Google cometeu esse crime de morte? Há alguma pista?

O poeta e a bactéria

O poeta canadense Christian Bök deseja que sua poesia sobreviva por bilhões de anos. Como? Inserindo um de seus poemas diretamente no DNA de uma bactéria, o Deinococcus radiodurans. Se funcionar, o poema vai durar mais do que a espécie humana. Mas é um processo complexo e Bök está fazendo o que pode para torná-lo ainda mais complicado. Por querer introduzir no DNA da bactéria uma sequência de nucleotídeos que produza uma proteína a ser interpretada como um poema.
E o poeta tenta criar um código que relacione os nucleotídeos (adenosina, citosina, guanina e timina, conhecidos por suas iniciais ACGT)) com as letras do alfabeto. No qual cada trinca de nucleotídeos corresponda a uma letra, de modo que, digamos, ACT represente a letra "a", AGT a letra "b", e assim por diante.

Christian Bök ainda não sabe. Mas teria o seu trabalho muito facilitado se recorresse a uma bactéria que é endêmica no Brasil. Qual? O Sonetococcus brasiliensis. PGCS

Postagem 212 do Acta Pulmonale

15 setembro, 2010

Que é um FDP?

Muitas vezes, formulamos a nós mesmos perguntas difíceis de serem respondidas. Como:
que é um FDP?

E burilamos postulados metafísicos, aforismos incompletos e sofismas incoerentes para, ao fim de tudo, descobrirmos que a única coisa certa é que uma imagem vale mil palavras.
Nesta foto, por exemplo, o cara da direita é um membro de um esquadrão antibombas a realizar um trabalho de desativação. E o cara por trás dele, bem... é um FDP.

MARTWALKER

Todo mundo ficava maravilhado com os passos que Michael Jackson fazia ao dançar MOONWALKER.
Porém, o que pouquíssima gente até hoje sabe era onde o cantor/dançarino ensaiava essa coreografia.


14 setembro, 2010

Medicina digital - 7


ESTE JOGO NÃO PODE DAR EMPATE

O que diz e o que significa

Se for mulher
Sim = Não
Não = Sim
Talvez = Não
Nós precisamos = Eu quero
Está desculpado = Desta vez passa
Nós temos de conversar = Você está em apuros
Certo, vá em frente = É melhor não tentar...
Faça o que deseja = Vai pagar por isso depois
Eu não estou aborrecida= É claro que eu estou com raiva, cretino!
Você está muito atencioso esta noite = Já está pensando em sexo!

Se for homem
Eu estou com fome = Eu estou com fome
Eu estou com sono = Eu estou com sono
Eu estou cansado = Eu estou cansado
Belo vestido! = Belo decote!
Eu a amo = Vamos fazer sexo agora
Eu estou entediado = Você quer fazer sexo agora?
Posso tirá-la para dançar? = Eu gostaria de fazer sexo com você
Posso lhe telefonar depois? = Eu gostaria de fazer sexo com você
Gostaria de ir ao cinema? = Eu gostaria de fazer sexo com você
Quer sair para jantar? = Eu gostaria de fazer sexo com você
Aqueles sapatos não combinam com aquele vestido = Eu sou gay

(traduzido livremente do inglês)

13 setembro, 2010

O Evacuchute

Ele é o mais seguro e confiável paraquedas que existe para uma evacuação de emergência.
A respeito dele, o blogueiro Piero Barcellos escreveu no Void:


"Certo que já lhe passou pela cabeça se atirar pela janela do escritório diante de uma dessas situações. Mas o medo de se esborrachar na calçada e ter que ir trabalhar todo arrebentado no dia seguinte geralmente fala mais alto. Pois eis que surge nos Estados Unidos o Evacuchute. Trata-se, nada mais nada menos, de um pequeno paraquedas usado para saltar curtas altitudes, como do terraço de um prédio, por exemplo.
O objetivo real do invento é proporcionar a evacuação de lugares altos com maior rapidez em casos de acidentes, como incêndios, em que o cara não consegue chegar à escada de incêndio a tempo de se livrar de ser tostado (é certo que os mais ansiosos usarão o equipamento para saltarem fora do escritório, assim que o expediente acabar na sexta-feira). Mas, se depender de sua empresa para adquirir um destes para a sua segurança, eles vão preferir deixá-lo queimando e chamar um estagiário para o seu lugar, que sai mais barato: cada unidade do Evacuchute custa US$2.495."

12 setembro, 2010

O homem do duplo arco-íris

Paul Vasquez, que se tornou famoso no YouTube neste ano, após publicar um vídeo em que se emocionava ao encontrar um arco-íris duplo, é o novo garoto propaganda da Microsoft. Ele foi escolhido para estrelar um filme promocional da Windows Live Photo Gallery. Nele, Vasquez novamente encontra o arco-íris duplo e começa a fotografá-lo. Em seguida, cria uma foto panorâmica e a disponibiliza na web.



Ele é atualmente uma webcelebridade. Com mais de 13 milhões de visualizações do vídeo que filmou em Yosemitebear Mountain, Vasques foi convidado para participar de talk shows e até lançou uma linha de camisetas próprias. O vídeo se tornou um meme e ganhou vários remixes no YouTube.

11 setembro, 2010

A bola e o besouro


A bola conduzida por um "besouro".

A bola, por ser a Jabulani, é leve, muito fácil de ser levada. Mas, como não existe besouro grande assim, acredito que a figura acima seja o resultado de uma montagem fotográfica.
Só que o criador da imagem pegou pesado.
Por usar uma imitação do besouro rola-bosta, que tem este nome devido ao costume de rolar esferas de esterco pelas pradarias, e por acrescentar à imagem uma legenda nada cordial: SOCCER IS SHIT!
Ele deve viver em um país onde se joga o futebol com as mãos.

O peru do padre

Ou: sobre a importância da comunicação correta
O vigário de um lugarejo criava um peru como mascote. Certo dia, o peru desapareceu e ele achou que alguém o havia roubado.
No dia seguinte, na missa, o vigário perguntou aos fiéis:
-Algum de vocês aqui tem um peru?
Todos os homens se levantaram.
-Não, não, disse o vigário, não foi isso que eu quis dizer. O que eu quero saber é se algum de vocês viu um peru?
Todas as mulheres se levantaram.
-Não, não, repetiu o vigário, o que eu quero dizer é se algum de vocês viu um peru que não lhes pertence.
Metade das mulheres se levantou.
- Não, não, disse o vigário novamente muito atrapalhado. Talvez eu possa formular melhor a pergunta: O que eu quero saber é se algum de vocês viu o meu peru?
Todas as freiras se levantaram.
-Ah, deixem pra lá!

10 setembro, 2010

Lagartixa azul


Um conto de Nelson José Cunha


O sono não veio como de costume. Pacheco foi tomado pelos insistentes pensamentos dos insones: Velhas lembranças da infância, saudade dos pais já falecidos e as luaradas onde conheceu Isabel. Um sono roubado e uma noite em claro têm sempre a sua serventia: Ajuda-nos a refletir e elaborar projetos de vida. Quantas decisões importantes já brotaram de noites assim?
A noite do insone é também a primazia dos ouvidos, todo sussurro é notado: A mariposa que se debate no lustre, o motor da geladeira que se faz notar, o namoro dos felinos no telhado e até o tic-tac do relógio de pulso. Os seres ignorados durante o dia mostram-se à noite para a audiência dos insones.
E foi acompanhando as batidas do relógio cuco que Pacheco alcançou o dia. Preparava-se para se aninhar no usual soninho do raiar do dia, quando Isabel entrou no quarto com um comprimido em cada mão.
- Toma logo que já está na hora de sair.
Estava combinado que Pacheco seria internado num hospital psiquiátrico para tratamento da dependência alcoólica. A primeira vez em cinquenta anos de vida que o nosso personagem entraria num hospital como paciente. Foram meses de relutâncias antes que ele aceitasse a desintoxicação. A insistência da mulher e as alucinações cada vez mais freqüentes fizeram com que concordasse com o tratamento.
* * * * *
Tudo começou com a visão de lagartixas coloridas correndo pelo muro da casa. Havia-nas em vermelho sangue, amarelo canário e até umas poucas azuis, todas a lhe desafiarem o tino. Chamava então a mulher ou quem estivesse por perto.
- Vem ver, vem ver...
Mas as lagartixas não esperavam, desapareciam por cima do muro antes que a testemunha as visse. Pacheco desapontado insistia
- Tem sim, eu vi, eram duas, uma de cada cor.
Os olhares se cruzavam piedosos da evidente alienação do Pacheco. Ele, tão compenetrado, estava entregue nas mãos do delírio. O álcool é o bom veneno, pois entorpece antes de matar os amantes dos seus vapores.
* * * * *
O compadre Amandito, o amigo das horas amargas, chegou para conduzi-lo ao Asilo de Parangaba. Pacheco entrou no carro e encolheu-se no banco traseiro da Variant. Era um homem derrotado. Rosto virado para a janela e o olhar preso aos seus pensamentos. Ainda duvidava da veracidade das alucinações. As lagartixas pareciam tão verdadeiras que até se lhe ouviam os ruídos das patas em movimento. Algumas chegavam a desprender o limo do muro à sua passagem. Outras nem coloridas eram, tinham mesmo a cor discreta de lagartixa. Para estas, todos tinham olhos de vê-las, mas as coloridas ficavam somente para a mente afetada do pobre Pacheco.
Chegando ao hospital, iniciou-se a típica operação padrão ao se internar alguém em hospitais públicos: Tratamento impessoal e frio como uma linha de produção de frangos congelados. Pacheco recebeu um pijama de saco e a usual injeção de calmante que lhe desarmou o esfíncter. Seguiu a pé pelo longo corredor, pingando xixi para desespero da faxineira que seguia atrás com pano e balde a praguejar e limpar. Isabel assistia à cena de longe, braços caídos e pernas trêmulas, vencida. Não resistindo à derrota do seu herói, chorou. O Pacheco que conheceu no vigor dos seus 18 anos, artilheiro do Ubajarense, mijava-se pelo corredor do hospital.
* * * * *
Chegando à casa, Isabel sentou-se na velha cadeira de balanço para refletir sobre o futuro e atribuir-se culpa pela desgraça do marido como usam fazer as mulheres honestas e apaixonadas. Estava em pensamentos e choros quando de repente surge uma lagartixa azul das maiores. A lagartixa parou, acenou a cabeça e partiu como um raio para desaparecer no alto do muro.
Refeita do susto, Isabel levantou-se para buscar a escadinha de abrir. Subiu e assomou ao muro para ver o quintal do novo vizinho. Havia uma oficina de lanternagem para automóveis. Ao funileiro que transitava por perto perguntou sobre a tal lagartixa azul. Ouviu então, a história mais deliciosa da sua vida: O rapaz, grande brincalhão, ao final de cada jornada, para não entupir o bico da pistola de pintura, adicionava-lhe um pouco de thinner e descarregava o seu conteúdo no muro e nas lagartixas que porventura passassem na hora. Poucas lhe escapavam ao riso e ao jato colorido
* * * * *
Naquela mesma noite Pacheco dormiu em casa, enrodilhado nos braços de Isabel.

09 setembro, 2010

Questão de formas

Se Níger tem a forma de uma coxinha...

que país tem a forma de um...


Estatística. Conclusões inverossímeis

  • No Estado do Vaticano(*) há dois papas por quilômetro quadrado.
  • A probabilidade de acontecer um acidente de trânsito aumenta com a duração da viagem. Mais rápido que alguém consiga chegar ao destino, menor é a chance de se envolver num acidente.
  • A taxa de natalidade, ao ser o dobro da taxa de mortalidade, faz com que uma de cada duas pessoas seja imortal.
  • Se uma pessoa tem os pés no freezer e a cabeça no forno a sua temperatura média será normal.
  • Embarcar num avião com uma bomba garante que a viagem será segura. A probabilidade de duas pessoas que não se conhecem e que transportam bombas no mesmo voo é praticamente zero.
  • Em média, o ser humano tem um testículo e uma mama.
  • Os 20 por cento dos medicamentos que são vendidos nas farmácias sem receita médica são compensados pelos 20 por cento dos medicamentos que são tomados por pessoas não doentes.
  • Numa determinada categoria, 9 de cada 10 pessoas pensam que 1 de cada 10 é um imbecil.

(*) o Vaticano tem uma área de cerca de 0,5 km2.
Fonte: TamTam
Como contar a mentira dizendo só a verdade
Uma manchete da "Folha" referente ao Brasil:

EM 20 ANOS SOBE 39% A PROPORÇÃO DE MORTES NEONATAIS

A mortalidade neonatal é medida pelo número de óbitos na faixa etária de 0 a 28 dias para cada mil nascidos vivos. No período de 1996 a 2004, a taxa caiu, em números absolutos, de 20 para 15 mortes neonatais por mil nascidos vivos (houve queda).
A mortalidade infantil é medida pelo número de óbitos em menores de 1 ano para cada mil nascidos vivos. No mesmo período, a taxa caiu, em números absolutos, de 14 para 7,7 óbitos infantis por mil nascidos vivos (houve queda maior).
É claro que proporcionalmente a mortalidade neonatal aumentou em relação à mortalidade infantil geral.

08 setembro, 2010

A farsa do boa-pinta

Neste ano - de eleição - não convém tirar de foco o "Farol da Alexandria", uma das 7 Maravilhas do Mundo Neoliberal.

"Eu, em 1978, vi surgir a primeira greve de trabalhadores durante a ditadura. Em 1980, o movimento radicalizou, sendo que inúmeras lideranças sindicais foram presas e muitos grevistas se refugiaram na igreja matriz de São Bernardo do Campo, acolhidos por Dom Cláudio Humes. A repressão cercou a igreja e a situação dos grevistas lá dentro ficou desesperadora. Eu, junto com outros companheiros, nos mobilizamos para dar algum conforto moral e material àquelas pessoas, ao lado de inúmeros outros que formaram uma verdadeira corrente humana de solidariedade. Inúmeras vezes fomos até lá com o carro cheio de comida, cobertores e medicamentos para tentar minorar a situação dos valorosos companheiros encurralados."

O filho de Dona Lindu num comício. Onde está o Filho da Outra?

"Num dia daqueles, vi Fernando Henrique, que tínhamos apoiado na campanha para senador em 1978, na porta da igreja. Vestido, como sempre, como um dândi ficou batendo papo com algumas pessoas (que depois viraram expoentes do PSDB), até que chegou a TV. Na mesma hora, tirou o pull-over, arregaçou as mangas da camisa e começou a pegar os mantimentos que tínhamos trazido e a entregar para os companheiros grevistas, como se fossem dele, para a TV filmar. Nem nos olhou na cara. Este é o 'intelectual', o mentor do PSDB, o farsante que quer nos enganar (e enganou uma vez). Acredito, com a fé que tenho no meu povo, que esta escória não passará em outubro de 2010."

(extraído da denúncia feita por Nylson, ao blog Conversa Afiada)

Na ponta do lápis

Muitos artistas usam lápis para criar seus desenhos. Apenas um consegue criar neles obras-primas deslumbrantes.
É Dalton Ghetti, um carpinteiro de Connecticut, EUA, de 49 anos, 25 dos quais dedicados a esculpir minúsculas imagens de objetos nos grafites dos lápis.
Recusa-se a usar lupa para a execução de seus trabalhos. E nunca os comercializa, prefere doá-los a amigos.
Ao final deste slideshow, você pensará assim:
"Que pena não ser um amigo dele?"


07 setembro, 2010

Dom Pedro: I no Brasil e IV em Portugal

"Conto em detalhes o que aconteceu com Dom Pedro depois de ele abdicar do trono brasileiro. Geralmente, os brasileiros acham que ele evaporou no ar, sumiu. E não, ele voltou para Portugal para enfrentar o irmão numa guerra épica entre liberais e absolutistas. Venceu essa guerra, mesmo tendo tudo contra ele – desembarcou na cidade do Porto com 7 mil soldados, e o irmão tinha 80 mil. E virou o jogo, ganhou a guerra, se revelou um general carismático, brilhante, que passava as noites nas trincheiras ao lado dos soldados. Morreu em seguida, porque a guerra contra o irmão destruiu a saúde dele. A autópsia revelou um corpo destruído: tuberculose, sífilis, o coração e o baço inchados... Se você compara as iconografias, o Dom Pedro IV de Portugal não tem nada a ver com o Dom Pedro I do Brasil. Aqui é um rapaz quase imberbe, muito jovem, um príncipe de 23 anos que faz a independência. Lá, não, é um rei envelhecido, com olheiras, a barba comprida. É como se o Dom Pedro de Portugal fosse o pai ou o avô dele. Até na iconografia esses dois países não se reconhecem no mesmo personagem. Ele passou a vida dividido entre os negócios de Portugal e do Brasil, tentando equilibrar esses dois pratos. E depois da morte continua dividido: o coração está guardado na cidade do Porto e os restos mortais, aqui no Ipiranga. É um personagem que passa para a história de uma forma muito pejorativa, como se fosse apenas um mulherengo, boêmio, inconsequente. Ele era, sim, mas não era só isso. É um grande transformador da realidade de Brasil e de Portugal naquele momento, um chefe liberal. Outorgou ao Brasil em 1824 uma das Constituições mais liberais do mundo na época – mas ele outorgou, não deixou a Constituinte fazer. É um homem de índole autoritária e discurso liberal. Admirador de Napoleão, que tinha feito o pai dele fugir de Portugal. Foi parente duas vezes de Napoleão, nos dois casamentos.

Trecho de uma entrevista de Laurentino Gomes, autor do bestseller "1808". In: Blogue de Actualidade Luso-Brasileira

A Guerra Civil Portuguesa, de 1828 a 1834,
que opôs as forças liberais de Dom Pedro IV
às tropas absolutistas de Dom Miguel I

Futebol acrobático - 2

Com esta defesa René Higuita entrou para a história do futebol. Há exatos 15 anos (07/09/1995), o goleiro colombiano fez isso (vídeo) no Estádio de Wembley, num jogo contra a seleção da Inglaterra.
A jogada ficou conhecida como a "defesa do escorpião".


06 setembro, 2010

Cuidado com o que fala

... as estátuas também têm ouvidos.

(enviada por Nelson Cunha)

Animais habilidosos

Por séculos, filósofos alegaram que a capacidade de fazer ferramentas separava os homens dos outros animais. Mas, em 1960, uma jovem pesquisadora da vida selvagem, Jane Goodall, contou a seu chefe, o antropólogo Louis Leakey, que ela vira chimpanzés arrancando folhas de galhos e, a seguir, usando-as para "pescar" cupins.
O atônito Leakey respondeu:
"Agora nós teremos de redefinir o que é ferramenta e o que é homem ou, então, aceitar os chimpanzés como seres humanos."
Claro, hoje nós sabemos que os chimpanzés foram apenas o começo...


ELEFANTES BEBEM ÁGUA ENGARRAFADA
GOLFINHOS DISFARÇAM SUAS BOCAS COM ESPONJAS
CHIMPANZÉS FABRICAM QUEBRA-NOZES
CORUJAS APROVEITAM O ESTRUME DAS VACAS
CORVOS PRODUZEM E ADAPTAM FERRAMENTAS
COM PEDRAS ABUTRES QUEBRAM OVOS DE AVESTRUZES
GARÇAS PESCADORAS

Conheça essas habilidades dos animais, lendo o artigo The Handiest Creatures in the Animal Kingdom, de David Goldenberg, republicado no Neatorama.

Postagem 211 do Acta Pulmonale

05 setembro, 2010

A foguete


Quando a gente vê essa (na imagem acima), como sendo a mais moderna técnica de distração extração de dentes, nem imagina que tudo começou de uma forma artesanal.


Por arco e flexa

Antes de o foguete ser lembrado para as extrações dentárias, elas eram feitas por arco e flexa. Mas só quando havia em casa um paizinho debilóide e metido a arqueiro.
Um vídeo natalino de 46 segundos para conferir isso.



Oh, dúvida!
O pai arranca três dentes de leite da filha? O pai faz três tomadas (ou três edições) da mesma cena?

04 setembro, 2010

Quarentena

:-)

Tradução
Permaneça em casa se você estiver doente até ficar livre dos sintomas por 24 horas ou 7 dias, o que for mais tempo. Isto evitará que você infecte os outros.

Ver + em AmyOops!: In Need of Medical Help?

Postagem 210 do Acta Pulmonale

Miss Universo

O Concurso de Miss Universo é uma competição internacional de beleza feminina, realizada anualmente e promovida pela Miss Universe Organization, cujo proprietário é Donald Trump.
EntreMentes mostra - em números - como tem sido, ao longo dos anos, os resultados finais da competição, conforme a procedência das candidatas vencedoras.

03 setembro, 2010

Recuperando as forças

- É AQUI QUE O CONDE SÉRRULA REPOUSA...

ENQUANTO RECEBE SUAS TRANSFUSÕES DE DOSSIÊ.

A CRONOLOGIA DA BALA DE PRATA

Por Alberto Bilac de Freitas (publicado em Luis Nassif Online)

Para se entender a lógica desse episódio da violação do sigilo fiscal de Verônica Serra (*), a gênese de tudo e as entranhas da que seja, talvez, a mais bem-urdida trama de espionagem político-eleitoral jamais tentada, há que se raciocinar como um deles; há que pensar como um, digamos, operador das profundezas do subterrâneo malcheiroso em que se transformaram o entorno e o núcleo da entourage próxima a José Serra.
A cronologia do bestialógico:
2005 – Passado o ápice do mensalão, Serra avaliava que Lula seria reeleito em 2006. A partir daí, seguiu-se o roteiro de empurrar Alckmin para a derrota anunciada. Decidira-se desde aí, que a chance de Serra seria em 2010, quando Lula já não poderia ser candidato. Mas o núcleo da inteligência serrista, coordenado por Marcelo Itagiba, sugeriu um laboratório do que seria aplicado em 2010: o escândalo dos aloprados, em 2006, por pouco não derrota Lula. Mas o objetivo era esse mesmo: um teste, para ver se o método aplicado com sucesso em 2002 com o caso Lunus, implodindo a candidatura Roseana, poderia ser reeditado. A armação com o delegado Edmilson Bruno, levando a eleição presidencial para o segundo turno, mostrara a viabilidade do método.
2008 – Com a articulação de Aécio Neves para o ser o candidato do partido em 2010, o staff de Itagiba começa a fazer um trabalhinho miúdo sobre o mineiro; coisa de pequena monta, que não inviabilizasse o apoio deste a Serra, no futuro, mas o suficiente para afastá-lo da disputa. Quando os esbirros de Serra na mídia lançaram a senha: Pó pará, governador! Aécio entendera que a turma era da pesada e não estava para brincadeiras. Nasceu aí o contra-ataque aecista: Amauri Ribeiro Júnior, então em um periódico mineiro, encabeçaria o projeto do contra-ataque e municiaria a artilharia mineira. Essa batalha subterrânea duraria até o final de 2009, quando Aécio recuaria.
2009 – Durante a batalha entre os dois grupos tucanos, Serra fica sabendo da farta e explosiva munição recolhida por Ribeiro Jr. O núcleo de sua equipe de inteligência, coordenado por Itagiba e que o acompanha desde os tempos do Ministério da Saúde, o adverte então: o material era nitroglicerina pura. Urgia providenciar um fogo de barragem, que pudesse ao menos minimizar o estrago quando o material viesse a público. Nasceu então, aí, nesse espaço-tempo, o hoje famoso dossiê "quebra de sigilo de Verônica Serra"! Notem que os personagens envolvidos na 'quebra de sigilo' são os mesmos do livro do Amauri: José Serra, Ricardo Sérgio de Oliveira, Gregório Marin Preciado, Mendonça de Barros e Verônica Serra (aí leia-se também Verônica Dantas e seu irmão, o querubim Daniel). Eduardo Jorge foi inserido aí como seguro. Próximo a FHC, mas não de Serra, EJ era o seguro contra qualquer atitude intempestiva de FHC, sabidamente não confiável, para que se mantivesse quieto quando a artilharia pesada viesse à tona.
2009 – Tomada a decisão, parte-se para o fogo de barragem. A parte mais fácil foi a montagem da 'quebra' de sigilo fiscal das vítimas. A incógnita, até agora, é que tipo de envolvimento tem o laranja Antônio Carlos Atella com a operação. Se é apenas mais um cavalo, o clássico operador barato, facilmente descartável, com acesso a algumas informações úteis e suficientes e lançador da isca fundamental: "Não me lembro quem foi... com certeza é alguém que quer prejudicar o Serra". Ou se é alguém orgânico, um insider dos intestinos itajibistas!
2010 – Com a desistência de Aécio, o grupo fica com a arma na mão, à espera da publicação do livro. É aí que se opera a clivagem para o quadro definitivo que vemos hoje: não é suficiente esperar o ataque do Aécio, que pode não vir, já que o mineiro recolheu suas baterias para o front de Minas Gerais. É preciso partir para o ataque. Além de neutralizar o grupo de Aécio, jogar pensando na frente, em fubecar a campanha de Dilma Roussef. Reeditar o mesmo estratagema de 2006. Ganhar a eleição na mão grande. O delegado Onésimo (outro que acompanha o grupo desde os tempos do bureau de inteligência do Ministério da Saúde) seria despachado para contactar o inimigo. Pausa. Agora recortem os informes dos integrantes do ex-comitê de inteligência de Dilma: tanto Lanzetta quanto Amauri reportam que Onésimo sugeriu insistentemente ao comitê, a realização de ações de contra-inteligência contra Serra. O azar deles é que Amauri, jornalista macaco velho e com conhecimento da comunidade de informações, sentiu logo o cheiro de queimado e cortou, de pronto, as ofertas de Onésimo. Não houvesse a negativa de Amauri, o passo seguinte de Onésimo seria a oferta do dossiê (já pronto) com a quebra de sigilo fiscal dos 5 tucanos. Estaria pronta e armada a reedição do escândalo dos aloprados em sua segunda versão. A campanha de Dilma não resistiria. A versão dos aloprados de 2006, perto desta, seria pinto. Era o modo mais seguro de Serra se eleger presidente. Esse é o modus operandi de Serra.
Com a recusa do ex-comitê de Dilma em morder a isca, tiveram que refazer o plano. O PT aprendera com os aloprados de 2006. Dilma, nesse ponto, muito mais impositiva que Lula, decepa no nascedouro o comitê de inteligência. O projeto original se complicara. Com o dossiê pronto desde 2009, a solução era vazá-lo, aos poucos, para a mídia parceira. Primeiro, vaza-se o EJ. Cria-se uma comoção (se bem que EJ, como vítima, não ajuda muito). Depois, a conta gotas, vem o restante: Ricardo Sérgio, Marin Preciado e Mendonça de Barros. E por fim, a cereja do bolo: Verônica Serra. Observem que o momentum foi escolhido a dedo por Serra: a entrevista em um grande telejornal! De novo, a semelhança: em 2006, os pacotes de dinheiro do delegado Bruno saíram no Jornal Nacional, da Globo; agora, o momento 'pai ultrajado' de Serra, foi encenado no Jornal da Globo! A intelligentsia serrista já foi mais original.
Diante desse quadro, o leitor inquieto deve estar se perguntando: o que deve fazer o PT e a campanha de Dilma? Assistir, inertes, a mais uma escalada golpista, como foi a de 2006? Tentar fazer o contraponto em uma mídia claramente parcial, golpista e oposicionista, conforme confessou dona Judith Brito, diretora da ANJ? O que fazer? O governo sabe onde está o antídoto ao veneno golpista da oposição! Não sei até que ponto o jornalista Amauri Ribeiro Júnior está integrado à campanha de Dilma Roussef. Também não sei até que ponto vai o empenho dele em livrar o país do ajuntamento político mais nefasto que o infesta, desde a redemocratização. O fato é que o seu livro, Os Porões da Privataria, é esse antídoto! Esse livro, verdadeira bateria anti-aérea que pode abater o núcleo duro do tucanato ligado à Serra, e o próprio Serra, de uma só vez, pode ajudar o Brasil a virar uma das páginas mais negras de seu curto período democrático!

(*) CANTO DE VERÔNICA (a propósito)
O vos omnes qui transitis per viam adtendite et videte si est dolor sicut dolor meus quoniam vindemiavit me ut locutus est Dominus in die iræ furoris sui.
Não vos comove isto a todos vós que passais pelo caminho? Atendei e vede se há dor como a minha dor, que veio sobre mim, com que o Senhor me afligiu no dia do furor da sua ira. PGCS

Enquanto chovia

A história da invenção das palavras cruzadas contada "comme il faut"
Certa vez o "que possui milhões" Vitor Orile, encontrando-se em "cidade à margem do Tâmisa", recebeu convite para jantar na casa de um "pessoa com afeição recíproca". Orile foi. Como chovia torrencialmente, "sexta nota musical" pelas tantas, depois de servido o "infusão feita com o fruto do cafeeiro", o "aquele que recebe convivas à sua mesa", lhe perguntou:
- O que se pode fazer em uma noite de "precipitação atmosférica sob a forma de gotas" para matar o "medida de duração dos fenômenos"?
- Um destes "dois elevado ao quadrado" entretenimentos, respondeu Orile. Jogar "ponte, em inglês", contar "narrativa curta e picante", fazer "ações de adivinhar" e tocar "instrumento musical que sucedeu ao cravo".
Mas, enquanto falava, Orile, com o "articulação que reúne o braço e o antebraço" apoiado na mesa, se entretinha rabiscando letras e quadrículas nos pedaços de uma "lâmina delgada feita de celulose". De repente, exclamou:
- Enganei-me. Podemos fazer "o número de sentidos do corpo" coisas. Acabo de inventar um novo "ocupação ligeira e agradável".
Foi como Orile inventou as palavras cruzadas. PGCS

02 setembro, 2010

Rumo à imortalidade

A salamandra, caso aconteça de perder uma das extremidades, tem a capacidade de criá-la novamente. O fenômeno é conhecido pelos biólogos e pelas pessoas em geral (muitas das quais insistem em provocar a tal perda para o sofrimento da salamandra).
Essa propriedade regenerativa é chamada de transdiferenciação e deve-se ao fato de que, na espécie, existem células que se transformam espontaneamente em células diferenciadas, as quais, por sua vez, reconstroem a parte amputada do corpo do animal.
Superiormente dotada do recurso da transdiferenciação do que a salamandra, a medusa Turritopsi nutricola (uma espécie de água-viva, mostrada na figura abaixo), apresenta uma capacidade de regeneração ilimitada. Regenera todo o corpo de forma sistemática, invertendo inclusive o processo de envelhecimento.


Eis o Santo Graal da biotecnologia no século XXI: a juventude eterna, a imortalidade. Mas, como tudo na vida, apresenta também um preço: a superpopulação. Segundo a Dra. Mary Miglietta, do Smithsonian Tropical Marine Institute, essas medusas imortais, um dia habitantes exclusivos das águas do Caribe, já se espalharam por todo os oceanos.

Bryan, Nelson. The world's only immortal animal. In: Yahoo! Green

Postagem 209 do Acta Pulmonale

01 setembro, 2010

Discursos com aparte

Primeiro, a definição de aparte.
É a interrupção feita ao discurso de alguém a fim de acrescentar algum comentário ou manifestar uma opinião, seja favorável ou contrária.
Agora, qual é o seu aparte?
- AH, É? TAQUI PR'OCÊ, Ó!

Telas transparentes

Aqui está uma ilusão de óptica que você pode criar. A ilusão de que a tela de seu computador (ou notebook) é transparente.
É feita tirando uma foto do que está atrás da tela e aplicando a imagem obtida como "papel de parede" do computador.